| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | 002G02 | |
|---|---|---|
| Aliases: | 002G02_3 | [ View Alias Details ] |
| mt018j05 | [ View Alias Details ] | |
| mtgsp_002g02 | [ View Alias Details ] | |
| mth2-18j5 | [ View Alias Details ] | |
| Accession ID: | MtYoungUMinn2006_1_002G02 | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 1 |
[ View Map Details ] |
| Start: | 58.2 cM | |
| Stop: | 58.2 cM | |
| Forward primer: | taacgttactccctcctccg | |
| Genetic Map Marker Derived: | AC126014 | |
| No. of Repeats: | - | |
| Physical Map BAC Accession No: | AC126014 | |
| Physical Map BAC Name: | mth2-18j5 | |
| Product Size: | 253 | |
| Reverse primer: | tctccaacgaagttcaaggg | |
| SSR Motif: | ct | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.