LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "003F11"

Feature Name: 003F11
Aliases: 003F11_M [ View Alias Details ]
a_015e07 [ View Alias Details ]
h2_15e7a [ View Alias Details ]
mtgsp_003f11 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_1_003F11
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 1
[ View Map Details ]
Start: 46.1 cM
Stop: 46.1 cM
Forward primer: aattcgcttttcgattgccc
Genetic Map Marker Derived: AC135466
No. of Repeats: -
Physical Map BAC Accession No: AC135466
Physical Map BAC Name: mth2-15E7
Product Size: 277
Reverse primer: ccccaacattctcccctaat
SSR Motif: caaatt
Source: BAC
Correspondences

No correspondences to show.