LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "h2_103J7d"

Feature Name: h2_103J7d
Aliases: d_103j07 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_1_h2_103J7d
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 1
[ View Map Details ]
Start: 54.5 cM
Stop: 54.5 cM
Forward primer: gtattgggccgcttgactta
Genetic Map Marker Derived: AC146570
No. of Repeats: 19
Physical Map BAC Accession No: AC146570
Physical Map BAC Name: mth2-103J7
Product Size: 248
Reverse primer: gcctcccataatcaccaaga
SSR Motif: ta
Source: BAC
Correspondences

No correspondences to show.