LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "h2_23b18a"

Feature Name: h2_23b18a
Aliases: 001H07 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_1_h2_23b18a
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 1
[ View Map Details ]
Start: 18.3 cM
Stop: 18.3 cM
Forward primer: ttcaaccgtaccgctcttct
Genetic Map Marker Derived: AC122171
No. of Repeats: 8
Physical Map BAC Accession No: AC122171
Physical Map BAC Name: mth2-23b18
Product Size: 186
Reverse primer: tactgggttcacgcacaaaa
SSR Motif: tta
Source: BAC
Correspondences

No correspondences to show.