LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "h2_30h19b"

Feature Name: h2_30h19b
Aliases: b_030h19 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_1_h2_30h19b
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 1
[ View Map Details ]
Start: 17.1 cM
Stop: 17.1 cM
Forward primer: ggttcgtcgtaacaggtggt
Genetic Map Marker Derived: AC142507
No. of Repeats: 25
Physical Map BAC Accession No: AC142507
Physical Map BAC Name: mth2-30h19
Product Size: 215
Reverse primer: gaaggaagagtctcctcgca
SSR Motif: ta
Source: BAC
Correspondences

No correspondences to show.