![]() |
Feature Name: | h2_31a11e | |
---|---|---|
Aliases: | N/A | |
Accession ID: | MtYoungUMinn2006_1_h2_31a11e | |
Feature Type: | SSR | [ View Feature Type Info ] |
Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 1 |
[ View Map Details ] |
Start: | 41 cM | |
Stop: | 41 cM | |
Forward primer: | agtttccgattcagaagcca | |
Genetic Map Marker Derived: | AC150779 | |
No. of Repeats: | 6 | |
Physical Map BAC Accession No: | AC150779 | |
Physical Map BAC Name: | mth2-31a11 | |
Product Size: | 253 | |
Reverse primer: | tgtgcttccttcctcttcgt | |
SSR Motif: | aat | |
Source: | BAC |
Correspondences |
---|
No correspondences to show.