LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "h2_31p22d"

Feature Name: h2_31p22d
Aliases: N/A
Accession ID: MtYoungUMinn2006_1_h2_31p22d
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 1
[ View Map Details ]
Start: 47.8 cM
Stop: 47.8 cM
Forward primer: gtgattgggccatgaagaat
Genetic Map Marker Derived: AC146861
No. of Repeats: 13
Physical Map BAC Accession No: AC146861
Physical Map BAC Name: mth2-31p22
Product Size: 249
Reverse primer: gctgttgtggcatgtttgtt
SSR Motif: tg
Source: BAC
Correspondences

No correspondences to show.