| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | h2_49a9a | |
|---|---|---|
| Aliases: | a_049a09 | [ View Alias Details ] |
| Accession ID: | MtYoungUMinn2006_1_h2_49a9a | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 1 |
[ View Map Details ] |
| Start: | 32.4 cM | |
| Stop: | 32.4 cM | |
| Forward primer: | actgacttccggtttgtgga | |
| Genetic Map Marker Derived: | CG974722 | |
| No. of Repeats: | - | |
| Physical Map BAC Accession No: | CG974722 | |
| Physical Map BAC Name: | mth2-49a9 | |
| Product Size: | 244 | |
| Reverse primer: | atcctttcttcccaccgtttttg | |
| SSR Motif: | ct | |
| Source: | BES | |
| Correspondences |
|---|
No correspondences to show.