LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "h2_65l2a"

Feature Name: h2_65l2a
Aliases: N/A
Accession ID: MtYoungUMinn2006_1_h2_65l2a
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 1
[ View Map Details ]
Start: 61.9 cM
Stop: 61.9 cM
Forward primer: agctggttggtggctagaga
Genetic Map Marker Derived: AC149471
No. of Repeats: 39
Physical Map BAC Accession No: AC149471
Physical Map BAC Name: mth2-65l2
Product Size: 203
Reverse primer: gggagtagttgcttgcttgc
SSR Motif: at
Source: BAC
Correspondences

No correspondences to show.