| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | 001A10 | |
|---|---|---|
| Aliases: | 001A10_2 | [ View Alias Details ] |
| mt031d18 | [ View Alias Details ] | |
| mtgsp_001a10 | [ View Alias Details ] | |
| mth2-31d18 | [ View Alias Details ] | |
| Accession ID: | MtYoungUMinn2006_6_001A10 | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 6 |
[ View Map Details ] |
| Start: | 1.4 cM | |
| Stop: | 1.4 cM | |
| Forward primer: | ccatccttttacgatgaccg | |
| Genetic Map Marker Derived: | AC119412 | |
| No. of Repeats: | 33 | |
| Physical Map BAC Accession No: | AC119412 | |
| Physical Map BAC Name: | mth2-31D18 | |
| Product Size: | 207 | |
| Reverse primer: | ggcttaccaccaccacattc | |
| SSR Motif: | ta | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.