![]() |
Feature Name: | 003e11 | |
---|---|---|
Aliases: | 003E11_M | [ View Alias Details ] |
a_017k21 | [ View Alias Details ] | |
h2_17k21a | [ View Alias Details ] | |
mtgsp_003e11 | [ View Alias Details ] | |
Accession ID: | MtYoungUMinn2006_6_003e11 | |
Feature Type: | SSR | [ View Feature Type Info ] |
Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 6 |
[ View Map Details ] |
Start: | 27.6 cM | |
Stop: | 27.6 cM | |
Forward primer: | gagggtgtaagaccccagaa | |
Genetic Map Marker Derived: | AC135464 | |
No. of Repeats: | - | |
Physical Map BAC Accession No: | AC135464 | |
Physical Map BAC Name: | mth2-17K21 | |
Product Size: | 200 | |
Reverse primer: | attgcaggtaagatgcctaa | |
SSR Motif: | - | |
Source: | BAC |
Correspondences |
---|
No correspondences to show.