LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "003e11"

Feature Name: 003e11
Aliases: 003E11_M [ View Alias Details ]
a_017k21 [ View Alias Details ]
h2_17k21a [ View Alias Details ]
mtgsp_003e11 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_6_003e11
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 6
[ View Map Details ]
Start: 27.6 cM
Stop: 27.6 cM
Forward primer: gagggtgtaagaccccagaa
Genetic Map Marker Derived: AC135464
No. of Repeats: -
Physical Map BAC Accession No: AC135464
Physical Map BAC Name: mth2-17K21
Product Size: 200
Reverse primer: attgcaggtaagatgcctaa
SSR Motif: -
Source: BAC
Correspondences

No correspondences to show.