| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | h2_22h5a | |
|---|---|---|
| Aliases: | N/A | |
| Accession ID: | MtYoungUMinn2006_6_h2_22h5a | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 6 |
[ View Map Details ] |
| Start: | -1.5 cM | |
| Stop: | -1.5 cM | |
| Forward primer: | tggtcccataattgagccat | |
| Genetic Map Marker Derived: | AC147499 | |
| No. of Repeats: | 18 | |
| Physical Map BAC Accession No: | AC147499 | |
| Physical Map BAC Name: | mth2-22h5 | |
| Product Size: | 242 | |
| Reverse primer: | ccagaacgatgttgtgtcag | |
| SSR Motif: | at | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.