| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | 001C05 | |
|---|---|---|
| Aliases: | 001C05_2 | [ View Alias Details ] |
| mt011l03 | [ View Alias Details ] | |
| mtgsp_001c05 | [ View Alias Details ] | |
| mth2-11l3 | [ View Alias Details ] | |
| Accession ID: | MtYoungUMinn2006_1_001C05 | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 1 |
[ View Map Details ] |
| Start: | 19.2 cM | |
| Stop: | 19.2 cM | |
| Forward primer: | tactgggttcacgcacaaaa | |
| Genetic Map Marker Derived: | AC124216 | |
| No. of Repeats: | 8 | |
| Physical Map BAC Accession No: | AC124216 | |
| Physical Map BAC Name: | mth2-34o22 | |
| Product Size: | 186 | |
| Reverse primer: | ttcaaccgtaccgctcttct | |
| SSR Motif: | tta | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.