LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001A05"

Feature Name: 001A05
Aliases: 001A05_1 [ View Alias Details ]
mt010i09 [ View Alias Details ]
mtgsp_001a05 [ View Alias Details ]
mth2-10i9 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_2_001A05
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 2
[ View Map Details ]
Start: 49.2 cM
Stop: 49.2 cM
Forward primer: gcacgactgccaagtcttct
Genetic Map Marker Derived: AC119409
No. of Repeats: 24
Physical Map BAC Accession No: AC119409
Physical Map BAC Name: mth2-10I9
Product Size: 279
Reverse primer: cgaggaagtatttcattgcca
SSR Motif: att
Source: BAC
Correspondences

No correspondences to show.