LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001C12"

Feature Name: 001C12
Aliases: 001C12_2 [ View Alias Details ]
mt036b07 [ View Alias Details ]
mtgsp_001c12 [ View Alias Details ]
mth2-36b7 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_2_001C12
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 2
[ View Map Details ]
Start: 0 cM
Stop: 0 cM
Forward primer: cggttttggtggagaagttg
Genetic Map Marker Derived: AC130800
No. of Repeats: 17
Physical Map BAC Accession No: AC130800
Physical Map BAC Name: mth2-36B7
Product Size: 272
Reverse primer: tcttaatacccgtgggagca
SSR Motif: ata
Source: BAC
Correspondences

No correspondences to show.