LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001D10"

Feature Name: 001D10
Aliases: 001D10_1 [ View Alias Details ]
mt032j21 [ View Alias Details ]
mtgsp_001d10 [ View Alias Details ]
mth2-32j21 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_2_001D10
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 2
[ View Map Details ]
Start: 12.7 cM
Stop: 12.7 cM
Forward primer: tcgcaataaagacaaggaaaacaa
Genetic Map Marker Derived: AC126778
No. of Repeats: 35
Physical Map BAC Accession No: AC126778
Physical Map BAC Name: mth2-32J21
Product Size: 495
Reverse primer: agcagcatacactgaagtagatgg
SSR Motif: at
Source: BAC
Correspondences

No correspondences to show.