LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001E09"

Feature Name: 001E09
Aliases: 001E09_3 [ View Alias Details ]
mt029b13 [ View Alias Details ]
mtgsp_001e09 [ View Alias Details ]
mth2-29b13 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_2_001E09
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 2
[ View Map Details ]
Start: 17.8 cM
Stop: 17.8 cM
Forward primer: cgacggttaaaaatcttatggg
Genetic Map Marker Derived: AC124609
No. of Repeats: 17
Physical Map BAC Accession No: AC124609
Physical Map BAC Name: mth2-29b13
Product Size: 250
Reverse primer: gtgttgtgggaggaaccaat
SSR Motif: ag
Source: BAC
Correspondences

No correspondences to show.