| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | 001F06b | |
|---|---|---|
| Aliases: | mt016l02 | [ View Alias Details ] |
| mtgsp_001f06b | [ View Alias Details ] | |
| mth2-16l2 | [ View Alias Details ] | |
| Accession ID: | MtYoungUMinn2006_3_001F06b | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 3 |
[ View Map Details ] |
| Start: | -12 cM | |
| Stop: | -12 cM | |
| Forward primer: | caaccctaaccctcaccaaa | |
| Genetic Map Marker Derived: | AC122163 | |
| No. of Repeats: | - | |
| Physical Map BAC Accession No: | AC122163 | |
| Physical Map BAC Name: | mth2-16L2 | |
| Product Size: | - | |
| Reverse primer: | catgtaacgcttgaggctga | |
| SSR Motif: | - | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.