| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | e1_1f5e | |
|---|---|---|
| Aliases: | N/A | |
| Accession ID: | MtYoungUMinn2006_3_e1_1f5e | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 3 |
[ View Map Details ] |
| Start: | 27.5 cM | |
| Stop: | 27.5 cM | |
| Forward primer: | tgaaccccaacccctacata | |
| Genetic Map Marker Derived: | AC149205 | |
| No. of Repeats: | 11 | |
| Physical Map BAC Accession No: | AC149205 | |
| Physical Map BAC Name: | mte1-1f5 | |
| Product Size: | 212 | |
| Reverse primer: | ctcccatcattttgcacca | |
| SSR Motif: | tg | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.