| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | h2_21i11e | |
|---|---|---|
| Aliases: | N/A | |
| Accession ID: | MtYoungUMinn2006_3_h2_21i11e | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 3 |
[ View Map Details ] |
| Start: | 62.9 cM | |
| Stop: | 62.9 cM | |
| Forward primer: | agggaacagaaccagcttca | |
| Genetic Map Marker Derived: | AC141435 | |
| No. of Repeats: | 16 | |
| Physical Map BAC Accession No: | AC141435 | |
| Physical Map BAC Name: | mth2-21i11 | |
| Product Size: | 125 | |
| Reverse primer: | gaaaaaggacagtgcttcgg | |
| SSR Motif: | ac | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.