| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | h2_6g9b | |
|---|---|---|
| Aliases: | b_006g09 | [ View Alias Details ] |
| Accession ID: | MtYoungUMinn2006_3_h2_6g9b | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 3 |
[ View Map Details ] |
| Start: | 11.9 cM | |
| Stop: | 11.9 cM | |
| Forward primer: | cccgatcgcagacataaaat | |
| Genetic Map Marker Derived: | AC142396 | |
| No. of Repeats: | 11 | |
| Physical Map BAC Accession No: | AC142396 | |
| Physical Map BAC Name: | mth2-6g9 | |
| Product Size: | 272 | |
| Reverse primer: | aagccaaatccattgcttga | |
| SSR Motif: | ct | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.