LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001D02"

Feature Name: 001D02
Aliases: 001D02_1 [ View Alias Details ]
mtgsp_001d02 [ View Alias Details ]
mth1-23l16 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_4_001D02
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 4
[ View Map Details ]
Start: 10.3 cM
Stop: 10.3 cM
Forward primer: tcccaacgctttttcatttc
Genetic Map Marker Derived: AC119418
No. of Repeats: 26
Physical Map BAC Accession No: AC119418
Physical Map BAC Name: mth1-23l16
Product Size: 200
Reverse primer: gaacttgaagaagaacgccg
SSR Motif: tc
Source: BAC
Correspondences

No correspondences to show.