LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001A11"

Feature Name: 001A11
Aliases: 001A11_3 [ View Alias Details ]
mt033l22 [ View Alias Details ]
mtgsp_001a11 [ View Alias Details ]
mth2-33l22 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_5_001A11
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 5
[ View Map Details ]
Start: 75.1 cM
Stop: 75.1 cM
Forward primer: cacacacacacacccatgaa
Genetic Map Marker Derived: AC123570
No. of Repeats: 11
Physical Map BAC Accession No: AC123570
Physical Map BAC Name: mth2-33L22
Product Size: 226
Reverse primer: cgagctacaaacctcaaccc
SSR Motif: at
Source: BAC
Correspondences

No correspondences to show.