| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
Feature Name: | 001A11 | |
---|---|---|
Aliases: | 001A11_3 | [ View Alias Details ] |
mt033l22 | [ View Alias Details ] | |
mtgsp_001a11 | [ View Alias Details ] | |
mth2-33l22 | [ View Alias Details ] | |
Accession ID: | MtYoungUMinn2006_5_001A11 | |
Feature Type: | SSR | [ View Feature Type Info ] |
Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 5 |
[ View Map Details ] |
Start: | 75.1 cM | |
Stop: | 75.1 cM | |
Forward primer: | cacacacacacacccatgaa | |
Genetic Map Marker Derived: | AC123570 | |
No. of Repeats: | 11 | |
Physical Map BAC Accession No: | AC123570 | |
Physical Map BAC Name: | mth2-33L22 | |
Product Size: | 226 | |
Reverse primer: | cgagctacaaacctcaaccc | |
SSR Motif: | at | |
Source: | BAC |
Correspondences |
---|
No correspondences to show.