| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | 001E02 | |
|---|---|---|
| Aliases: | 001E02_2 | [ View Alias Details ] |
| mtgsp_001e02 | [ View Alias Details ] | |
| mth1-31p6 | [ View Alias Details ] | |
| Accession ID: | MtYoungUMinn2006_5_001E02 | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 5 |
[ View Map Details ] |
| Start: | 62.5 cM | |
| Stop: | 62.5 cM | |
| Forward primer: | cctctttcccgcttcttttc | |
| Genetic Map Marker Derived: | AC123575 | |
| No. of Repeats: | 9 | |
| Physical Map BAC Accession No: | AC123575 | |
| Physical Map BAC Name: | mth1-31P6 | |
| Product Size: | 274 | |
| Reverse primer: | gtccatataccatcgccacc | |
| SSR Motif: | ctc | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.