| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | 001F02 | |
|---|---|---|
| Aliases: | mtgsp_001f02 | [ View Alias Details ] |
| mth1-42h9 | [ View Alias Details ] | |
| Accession ID: | MtYoungUMinn2006_5_001F02 | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 5 |
[ View Map Details ] |
| Start: | 75.8 cM | |
| Stop: | 75.8 cM | |
| Forward primer: | gttttgtacccattttcttaaa | |
| Genetic Map Marker Derived: | AC131455 | |
| No. of Repeats: | 16 | |
| Physical Map BAC Accession No: | AC131455 | |
| Physical Map BAC Name: | mth1-42H9 | |
| Product Size: | 298 | |
| Reverse primer: | taaagccaagtgtatgtatagc | |
| SSR Motif: | tta | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.