LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001B01"

Feature Name: 001B01
Aliases: 001B01_2 [ View Alias Details ]
mtgsp_001b01 [ View Alias Details ]
mth1-3f12 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_6_001B01
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 6
[ View Map Details ]
Start: 48 cM
Stop: 48 cM
Forward primer: tagaaacacactcacccgca
Genetic Map Marker Derived: AC122722
No. of Repeats: 21
Physical Map BAC Accession No: AC122722
Physical Map BAC Name: mth1-3F12
Product Size: 201
Reverse primer: ggaattgcgacaactacggt
SSR Motif: a
Source: BES
Correspondences

No correspondences to show.