LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001C06"

Feature Name: 001C06
Aliases: 001C06_3 [ View Alias Details ]
mt014m14 [ View Alias Details ]
mtgsp_001c06 [ View Alias Details ]
mth2-14m14 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_6_001C06
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 6
[ View Map Details ]
Start: 0.7 cM
Stop: 0.7 cM
Forward primer: atgtttttcgcaattcgacc
Genetic Map Marker Derived: AC122724
No. of Repeats: 21
Physical Map BAC Accession No: AC122724
Physical Map BAC Name: mth2-14M14
Product Size: 223
Reverse primer: caagcaaccaaaacaacgtg
SSR Motif: ct
Source: BAC
Correspondences

No correspondences to show.