LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "005B08"

Feature Name: 005B08
Aliases: 005B08_M [ View Alias Details ]
b_011g20 [ View Alias Details ]
h2_11g20b [ View Alias Details ]
mtgsp_005b08 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_6_005B08
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 6
[ View Map Details ]
Start: 44.2 cM
Stop: 44.2 cM
Forward primer: gcgttagcatgggttaatgg
Genetic Map Marker Derived: AC140022
No. of Repeats: 10
Physical Map BAC Accession No: AC140022
Physical Map BAC Name: mth2-11G20
Product Size: 301
Reverse primer: gcaaacaatggtgtgtcgag
SSR Motif: ta
Source: BAC
Correspondences

No correspondences to show.