![]() |
Feature Name: | h2_102a8b | |
---|---|---|
Aliases: | b_102A08 | [ View Alias Details ] |
Accession ID: | MtYoungUMinn2006_6_h2_102a8b | |
Feature Type: | SSR | [ View Feature Type Info ] |
Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 6 |
[ View Map Details ] |
Start: | 44.2 cM | |
Stop: | 44.2 cM | |
Forward primer: | gacaaacgttcaatgccaca | |
Genetic Map Marker Derived: | AC146569 | |
No. of Repeats: | 39 | |
Physical Map BAC Accession No: | AC146569 | |
Physical Map BAC Name: | mth2-102A8 | |
Product Size: | 215 | |
Reverse primer: | ggctccctccacttgtaatg | |
SSR Motif: | ta | |
Source: | BAC |
Correspondences |
---|
No correspondences to show.