LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001A08"

Feature Name: 001A08
Aliases: 001A08_H [ View Alias Details ]
mtgsp_001a08 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_7_001A08
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 7
[ View Map Details ]
Start: 3.6 cM
Stop: 3.6 cM
Forward primer: ttaaattgcgaaacgcagaa
Genetic Map Marker Derived: AC119411
No. of Repeats: 14
Physical Map BAC Accession No: AC119411
Physical Map BAC Name: mth2-23C14
Product Size: 202
Reverse primer: gaaaccagtcagtgttggca
SSR Motif: ta
Source: BAC
Correspondences

No correspondences to show.