LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001B04"

Feature Name: 001B04
Aliases: 001B04_3 [ View Alias Details ]
mt005i15 [ View Alias Details ]
mtgsp_001b04 [ View Alias Details ]
mth2-5i15 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_7_001B04
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 7
[ View Map Details ]
Start: 0 cM
Stop: 0 cM
Forward primer: gatgatgaggatcaacggct
Genetic Map Marker Derived: AL387856
No. of Repeats: -
Physical Map BAC Name: mth2-5i15
Product Size: -
Reverse primer: caagttcgccatgaactcttc
SSR Motif: -
Source: cDNA
Correspondences

No correspondences to show.