| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
Feature Name: | 001B04 | |
---|---|---|
Aliases: | 001B04_3 | [ View Alias Details ] |
mt005i15 | [ View Alias Details ] | |
mtgsp_001b04 | [ View Alias Details ] | |
mth2-5i15 | [ View Alias Details ] | |
Accession ID: | MtYoungUMinn2006_7_001B04 | |
Feature Type: | SSR | [ View Feature Type Info ] |
Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 7 |
[ View Map Details ] |
Start: | 0 cM | |
Stop: | 0 cM | |
Forward primer: | gatgatgaggatcaacggct | |
Genetic Map Marker Derived: | AL387856 | |
No. of Repeats: | - | |
Physical Map BAC Name: | mth2-5i15 | |
Product Size: | - | |
Reverse primer: | caagttcgccatgaactcttc | |
SSR Motif: | - | |
Source: | cDNA |
Correspondences |
---|
No correspondences to show.