| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
Feature Name: | 001D08 | |
---|---|---|
Aliases: | 001D08_M | [ View Alias Details ] |
h2_23f15h | [ View Alias Details ] | |
h_023f15 | [ View Alias Details ] | |
mtgsp_001d08 | [ View Alias Details ] | |
Accession ID: | MtYoungUMinn2006_7_001D08 | |
Feature Type: | SSR | [ View Feature Type Info ] |
Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 7 |
[ View Map Details ] |
Start: | 2.2 cM | |
Stop: | 2.2 cM | |
Forward primer: | ccaacaatgcacaaaccatc | |
Genetic Map Marker Derived: | AC137994 | |
No. of Repeats: | 17 | |
Physical Map BAC Accession No: | AC137994 | |
Physical Map BAC Name: | mth2-23F15 | |
Product Size: | 252 | |
Reverse primer: | caacttgttggacaaccaca | |
SSR Motif: | tc | |
Source: | BAC |
Correspondences |
---|
No correspondences to show.