LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001D08"

Feature Name: 001D08
Aliases: 001D08_M [ View Alias Details ]
h2_23f15h [ View Alias Details ]
h_023f15 [ View Alias Details ]
mtgsp_001d08 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_7_001D08
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 7
[ View Map Details ]
Start: 2.2 cM
Stop: 2.2 cM
Forward primer: ccaacaatgcacaaaccatc
Genetic Map Marker Derived: AC137994
No. of Repeats: 17
Physical Map BAC Accession No: AC137994
Physical Map BAC Name: mth2-23F15
Product Size: 252
Reverse primer: caacttgttggacaaccaca
SSR Motif: tc
Source: BAC
Correspondences

No correspondences to show.