LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001F09"

Feature Name: 001F09
Aliases: 001F09_3 [ View Alias Details ]
mt030b20 [ View Alias Details ]
mtgsp_001f09 [ View Alias Details ]
mth2-30b20 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_7_001F09
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 7
[ View Map Details ]
Start: 49.1 cM
Stop: 49.1 cM
Forward primer: tctgaaagggcacctcctaa
Genetic Map Marker Derived: AC124218
No. of Repeats: 8
Physical Map BAC Accession No: AC124218
Physical Map BAC Name: mth2-30B20
Product Size: 282
Reverse primer: cgcgaaaggaatgttgaagt
SSR Motif: ct
Source: BAC
Correspondences

No correspondences to show.