LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "003B12"

Feature Name: 003B12
Aliases: 003B12_F [ View Alias Details ]
mtgsp_003b12 [ View Alias Details ]
mtgsp_003b12(2) [ View Alias Details ]
Accession ID: MtYoungUMinn2006_7_003B12
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 7
[ View Map Details ]
Start: 47.7 cM
Stop: 47.7 cM
Forward primer: gcttttgaggtcaaagtacaa
Genetic Map Marker Derived: AC135311
No. of Repeats: 18
Physical Map BAC Accession No: AC135311
Physical Map BAC Name: mth2-27L9
Product Size: 143
Reverse primer: cagggagtagcttgtaaatca
SSR Motif: at
Source: BAC
Correspondences

No correspondences to show.