LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "004A12"

Feature Name: 004A12
Aliases: 004A12_F [ View Alias Details ]
mt004a12 [ View Alias Details ]
mt_004a12 [ View Alias Details ]
mtgsp_004a12 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_7_004A12
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 7
[ View Map Details ]
Start: 64 cM
Stop: 64 cM
Forward primer: gaagaagaaaaagagatagatctgtgg
Genetic Map Marker Derived: AC135319
No. of Repeats: -
Physical Map BAC Accession No: AC135319
Physical Map BAC Name: mth2-6G4
Product Size: -
Reverse primer: ggcaggaacagatccttgaa
SSR Motif: -
Source: BAC
Correspondences

No correspondences to show.