LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "005A07"

Feature Name: 005A07
Aliases: 005A07_2 [ View Alias Details ]
mt017g16 [ View Alias Details ]
mtgsp_005a07 [ View Alias Details ]
mth2-17g16 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_7_005A07
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 7
[ View Map Details ]
Start: 2.9 cM
Stop: 2.9 cM
Forward primer: gccacaacatctgataggca
Genetic Map Marker Derived: AC140544
No. of Repeats: 26
Physical Map BAC Accession No: AC140544
Physical Map BAC Name: mth2-17G16
Product Size: 296
Reverse primer: tctgcagggaattccacata
SSR Motif: at
Source: BAC
Correspondences

No correspondences to show.