| CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial | | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial |
| Feature Name: | e1_27e16b | |
|---|---|---|
| Aliases: | N/A | |
| Accession ID: | MtYoungUMinn2006_7_e1_27e16b | |
| Feature Type: | SSR | [ View Feature Type Info ] |
| Map: |
Species: barrel medic Map Set: MtYoungUMinn2006 Map Name: 7 |
[ View Map Details ] |
| Start: | 3.6 cM | |
| Stop: | 3.6 cM | |
| Forward primer: | cctccgtgcgtataaaggaa | |
| Genetic Map Marker Derived: | AC157501 | |
| No. of Repeats: | 14 | |
| Physical Map BAC Accession No: | AC157501 | |
| Physical Map BAC Name: | mte1-27e16 | |
| Product Size: | 192 | |
| Reverse primer: | aaggaaacagcaacacatgg | |
| SSR Motif: | ct | |
| Source: | BAC | |
| Correspondences |
|---|
No correspondences to show.