LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "h2_34c9b"

Feature Name: h2_34c9b
Aliases: b_034c09 [ View Alias Details ]
h2_34c9a [ View Alias Details ]
Accession ID: MtYoungUMinn2006_7_h2_34c9b
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 7
[ View Map Details ]
Start: 63.2 cM
Stop: 63.2 cM
Forward primer: ggttgattaaccaccaccaaa
Genetic Map Marker Derived: AC144504
No. of Repeats: 8
Physical Map BAC Accession No: AC144504
Physical Map BAC Name: mth2-34c9
Product Size: 126
Reverse primer: ccttgaattcccccacttct
SSR Motif: at
Source: BAC
Correspondences

No correspondences to show.