LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001B06"

Feature Name: 001B06
Aliases: 001B06_3 [ View Alias Details ]
mt014g13 [ View Alias Details ]
mtgsp_001b06 [ View Alias Details ]
mth2-14g13 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_8_001B06
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 8
[ View Map Details ]
Start: 49.5 cM
Stop: 49.5 cM
Forward primer: catgggctgatacaacacaca
Genetic Map Marker Derived: AC121233
No. of Repeats: 16
Physical Map BAC Accession No: AC121233
Physical Map BAC Name: mth2-14G13
Product Size: 233
Reverse primer: gtttccacgtgaaagccagt
SSR Motif: tta
Source: BAC
Correspondences

No correspondences to show.