LIS - Legume Information System | CMap Home | Maps | Map Search | Feature Search | Matrix | Map Sets | Feature Types | Map Types | Evidence Types | Species | Help | Tutorial  

Feature "001E12"

Feature Name: 001E12
Aliases: 001E12_3 [ View Alias Details ]
mt036d22 [ View Alias Details ]
mtgsp_001e12 [ View Alias Details ]
mth2-36d22 [ View Alias Details ]
Accession ID: MtYoungUMinn2006_8_001E12
Feature Type: SSR [ View Feature Type Info ]
Map: Species: barrel medic
Map Set: MtYoungUMinn2006
Map Name: 8
[ View Map Details ]
Start: 21.4 cM
Stop: 21.4 cM
Forward primer: actctccttggaagggcaag
Genetic Map Marker Derived: AC124217
No. of Repeats: 26
Physical Map BAC Accession No: AC124217
Physical Map BAC Name: mth2-36d22
Product Size: 231
Reverse primer: tgacacacacacacacaccc
SSR Motif: tc
Source: BAC
Correspondences

No correspondences to show.